Znaleziono 244 wyniki

autor: Sil
25 mar 2008, o 15:35
Forum: Genetyka
Temat: Kilka pytań z genetyki molekularnej i stosowanej
Odpowiedzi: 6
Odsłony: 6471

Re: Kilka pytań z genetyki molekularnej i stosowanej

10 taki plazmid wprowadza się do innej komórki, i tak komórka produkuje antybiotyk Mam wątpliwości. Chodziło o gen odporności na ampicylinę, a nie gen kodujący ten antybiotyk. Gen odporności można wykorzystać np. do wyselekcjonowania bakterii, które uległy transformacji. Przykładowo: chcemy wprowad...
autor: Sil
25 mar 2008, o 13:42
Forum: Genetyka
Temat: Genetyka- problem z zadaniem
Odpowiedzi: 36
Odsłony: 7027

Re: Genetyka- problem z zadaniem

Beja pisze:0, ale wyjaśnienia nie jestem pewna - bo erytrocyt nie ma jądra, więc również nie ma chromosomów?
Dokładnie. Dojrzałe erytrocyty ssaków są bezjądrzaste, a co za tym idzie w ogóle nie posiadają genomu jądrowego, bo gdzie?
autor: Sil
24 mar 2008, o 19:34
Forum: Genetyka
Temat: Zadania domowe z genetyki.
Odpowiedzi: 660
Odsłony: 140652

Re: Zadania domowe z genetyki.

mRNA-UUCACAAAAGGUGGCUGGAUG, DNA-AAGTGTTTTCCACCGACCTAC Dorzucę jeszcze komplementarną nić DNA, żeby fragment był dwuniciowy: TTCACAAAAGGTGGCTGGATG Skiadam , mam propozycję. Może następnym razem nie pozwolisz malgosi35 rozwiązać całego zadania, tylko trochę pokombinujesz i przedstawisz przemyślenia? ...
autor: Sil
23 mar 2008, o 11:05
Forum: Przyrodnicze zagadki
Temat: Światło, prędkość, samochód.
Odpowiedzi: 29
Odsłony: 20747

Re: Światło, prędkość, samochód.

Całe szczęście nie da się tego zrobić, ale gdyby okazało się, że fizycy dotychczas strasznie się mylili i jakiś bolid da sięrozbujać do 1 warp", to pewnie nic by się nie stało. Światła reflektorów nikt by nie widział, bo pozostawałoby ono w miejscu powstania. Takie tylko moje przypuszczenia. Fizycy...
autor: Sil
21 mar 2008, o 22:56
Forum: Przyrodnicze zagadki
Temat: Ubrania zapałki i trup na pustyni...
Odpowiedzi: 28
Odsłony: 22336

Re: Ubrania zapałki i trup na pustyni...

Wypadł z samolotu? [ Dodano : Sob Mar 22, 2008 00:00 ] Leciał przeciążonym balonem, i został wylosowany do jego opuszczenia po wyrzuceniu z nego wszystkiego ci sie dało łącznie z ubraniami Przegral bidula losowanie. -stad ta zapalka. Zupełnie pominąłem zapałkę, ale chyba nawet, gdybym o niej pamięt...
autor: Sil
21 mar 2008, o 22:54
Forum: Nauki przyrodnicze
Temat: Twierdzenie Pitagorasa :(
Odpowiedzi: 46
Odsłony: 4799

Re: Twierdzenie Pitagorasa :(

Liceum Profilowane. To jest porażka na całej lini! Żadnego zawodu, brak przedmiotów w zakresie rozszerzonym To jest, niestety, święta prawda. Na dodatekzaśmiecacze w postaci nikomu do niczego niepotrzebnych przedmiotów zawodowych skutecznie utrudniają samodzielne przygotowanie się do matury. w doda...
autor: Sil
9 gru 2007, o 09:25
Forum: Przyrodnicze zagadki
Temat: Potrzosy Emberiza schoeniclus
Odpowiedzi: 8
Odsłony: 6865

Re: para ptaków

Potrzosy. Ładne
autor: Sil
28 wrz 2007, o 17:04
Forum: Biologia na studiach
Temat: biologia z chemią UWr
Odpowiedzi: 17
Odsłony: 11993

Re: biologia z chemią UWr

"statystyka dla przyrodników Łomnicki ^^! Dzięki Pamiętałaś, czy sprawdziłaś? witajcie ja studiuje ochronę środowiska a tam sama chemia z fizyką Nie strasz, że sama, boochroniarze z pierwszego roku magisterskich mieli z nami zoologię bezkręgowców A tak serio: ile macie godzin/semestrów poszczególny...
autor: Sil
27 wrz 2007, o 19:25
Forum: Biologia w szkole
Temat: Dlaczego rośliny wolą być 2n?
Odpowiedzi: 3
Odsłony: 531

Re: Dlaczego rośliny wolą być 2n?

shetanii pisze:Bo jak jedna nić DNA się popsuje to zostaje druga, i wiadomo jak naprawić tą pierwsza
A jeśli nawet naprawić się nie da, to niekorzystna mutacja może być u organizmów diploidalnych ukryta przez wiele pokoleń i nie wywoła negatywnych skutków u każdego nosicielarąbniętego allelu
autor: Sil
25 wrz 2007, o 13:33
Forum: Biologia na studiach
Temat: biologia na UWr
Odpowiedzi: 140
Odsłony: 28245

Re: biologia na UWr

A tym, że nie dostałaś się za pierwszym razem w ogóle się nie przejmuj. Miałem tak samo i stwierdzam, żenie ma tego złego, co by na dobre nie wyszło
autor: Sil
24 wrz 2007, o 21:08
Forum: Biologia na studiach
Temat: biologia z chemią UWr
Odpowiedzi: 17
Odsłony: 11993

Re: biologia z chemią UWr

Na UWr WF-y zaczynają się od trzeciego semestru. Z książek od samego początku nieodzowna jest właściwie tylko legendarnaAnatomia i histogeneza roślin naczyniowych Z. Hejnowicza. W dalszej kolejności warto załatwić sobie coś do zoologii bezkręgowców (Grabda, Dogiel. Autorów kilku książek podadzą Wam ...
autor: Sil
24 wrz 2007, o 20:56
Forum: Fizyka i astronomia
Temat: przekształcenie wzoru
Odpowiedzi: 9
Odsłony: 6931

Re: przekształcenie wzoru

Chodzi chyba o to, żeby ewentualne rozwiązanie móc przedstawić graficznie Przekształcenie można zrobić tak: √(2h/g)+h/v=t Porządkujemy tak, żeby po jednej stronie został tylko pierwiastek. Wiele to do sprawy nie wnosi, ale łatwiej będzie. h/v-t=√(2h/g) /² Obie strony podnosimy do kwadratu. (h/v-t)²=...
autor: Sil
24 wrz 2007, o 20:25
Forum: Przyrodnicze zagadki
Temat: Co to za związek chemiczny?
Odpowiedzi: 2
Odsłony: 15357

Re: Co to za związek chemiczny?

Może sialoza? (Nawet nie wiem, czy dobrze to napisałem )